Topic: Do you belive in God?
here is a topic to just sit back and debate
- Darth Rhyykol
- Jedi Master
- Offline
Re: Do you belive in God?
yes i do belive god
- Renegade Prince
- Jedi Master
- Offline
Re: Do you belive in God?
I know behind a shadow of a doubt that he does.
Re: Do you belive in God?
i will untill somebody has proff that he does not but then i still will belive in god
Re: Do you belive in God?
Yeah, I believe in God. And the proof you seek is in the Bible, plus it is all around you. Your genetic structure, the amazing enviroment around you is all proof that A Intelligent Designer made you and the earth.
The theory (Yeah, or lie) of Evolution has so many holes, and the 'proof' they have is not truth... but lies. It is incomplete, their theories are just rubbish lies sown together to decieve people. Plus, Evolutionists (or Athiests) are extremely bitter about God - Psycho Bitter - about Christianity. Plus, Evolution is a religion than a theory, as miraculous things had to have happened - as Evolutionists don't see - in order for it to happen. Proves the whole theory is false.
Evolution, btw, is the biggest hoax ever made. I think Global Warming get's second... Aliens is somewhere with that also.
Last edited by Hovoth (2009-12-05 23:11:13)
Wake up. You were dreaming. What's your name?
Re: Do you belive in God?
No i dont believe in god
I'm black....wait thats not right
Re: Do you belive in God?
good point havoth and why not amos
- Renegade Prince
- Jedi Master
- Offline
Re: Do you belive in God?
"A fool says in his heart, 'there is no god'".
Amos...you are a fool.
- Darth Rhyykol
- Jedi Master
- Offline
Re: Do you belive in God?
I have no Reason to belive in god.
Look at the bible, Anyone can write a book and anyone can put whatever they want in it,
Evoulotion is not 'Flawed', Every religion is flawed. You take the bible,adam & Eve, the bible states that they started the human race, we are all 'brothers and sisters' DNA tests prove nope...
Re: Do you belive in God?
Darth Rhyykol wrote:
Look at the Bible, anyone can write a book and anyone can put whatever they want in it.
If this is true, how does that explain the amazingly accurate words, proverbs, and revelations that are revealed? Oh - and keep in mind that these chapters were written more than 1,000 years ago.
Darth Rhyykol wrote:
Evolution is not 'Flawed', Every religion is flawed.
So you're saying to me, that a evolutionary system that is shown to have gaping holes, severe flaws (in terms of human analogy and body mapping), and a theory that states that humans came from a blob/monkey/ape does not sound stupid? It's clearly just a theory to try to ensure others that there is no God. Man just wants there not to be a God because he wants to do all he wants in life with no regrets.
Darth Rhyykol wrote:
You take the Bible, Adam & Eve, the Bible states that they started the human race, we are all 'brothers and sisters' DNA tests prove nope...
DNA is all linked to one accord, and what are these DNA tests that "Prove Nope"?
Wake up. You were dreaming. What's your name?
Re: Do you belive in God?
if you really new about the man who came up with the theory of evolution then you would know he later became christian and did belive in god and he denounced his theory of evolution
Last edited by Dangerous Seduction (2009-12-08 22:36:59)
- Darth Rhyykol
- Jedi Master
- Offline
Re: Do you belive in God?
He maybed, but the thing is,
Whats the evidence of god?
Re: Do you belive in God?
search your heart do you really think the universe was made by a big bang or that man kind really came from monkeys
- Darth Rhyykol
- Jedi Master
- Offline
Re: Do you belive in God?
... you tryin to convert me?
Re: Do you belive in God?
no i'm trying to get you to really think about it
- Darth Rhyykol
- Jedi Master
- Offline
Re: Do you belive in God?
Ok... im thinking... no.
I am sticking to evolotion
Re: Do you belive in God?
Whats the evidence of God?
The evidence, is like I said, all around you. You're body is scientifically amazingly designed. I can give you a quote (It's a big one) from somebody that mentioned it in their "Creation vs Evolution" debate. Here it is:
Just one cell is as intricate as a giant high-tech factory. On the outside there is a security system that only allows exactly the right goods in – the cell membrane. Elsewhere in the factory we see the power sources in the cell cytoplasm, which are accessed by the central memory bank – the cell nucleus. The nucleus stores and retrieves vast amounts of information, decoding artificial languages at bewildering speeds. Raw materials are directed along miles of corridors, and precision quality control mechanisms prevent any slip-ups. But then the cell does something no high-tech factory ever does. It reproduces itself within a few hours.
So what? Getting all of that to exist all in one go is a pretty tall order, no matter how long you've got. So how could the factory have just happened?
Chance? No.
To get the most basic living thing, the most basic cell, you would:
1. Have to have amino acids. These just ‘happen’ to exist.
2. Then of the many different types, you'd have to isolate the 20 amino acids which are usable for making proteins.
3. Next, you'd have to go through them one by one picking out only the left-handed ones.
4. Then you'd have to assemble the amino acids in exactly the right sequence.
5. You would then have to join them to special peptide bonds that fold three-dimensionally.If you hit the jackpot and got 100 amino acids in the right sequence, I am afraid you still would not have life – you would only have a measly, single protein. Another 200 or so proteins have to be formed and joined to even have the first glimmer of a chance of life.
Meanwhile, you would have to ensure that nothing interfered with your creation, because the chains of amino acids can be broken with a lot more ease than it takes to form them, so you would have to protect them somehow, and make sure nothing else reacted with them.
Basically, this process would need a designer.
Could DNA have just randomly happened? DNA is the design code. It is information, a code that tells the amino acids to arrange themselves in a special, complex sequence, creating proteins. A longer stretch of code is called a gene. DNA literally is the code of life, and would surely need an architect.
Look at it this way. I have a mobile, and I am going to send you a text message. There are 26 letters, plus some and punctuation to choose from.
I send you, 'AGGTTCTCCCAAGAGGTTCTCCCAAG'.
You'd think that it 'looks like a load of rubbish' (as if most text messages are not already). Stop being so hard on yourself. It is actually your nose.
It is a code. These letters are used as shorthand for the sequences of fragments of DNA e.g. CCAAGTAC.
A = Adenine T = Thymine – These two pair together
C = Cytosine G = Guanine – These two pair togetherThese sequences are the code for genetic information. It is a genetic code that your body understands and reads. And a much longer code like that determines the shape of your nose, and what shape your children's noses will be. Now, I will send you another message.
'MAKE YOUR NOSE LIKE SIMON COWELL’S NOSE'
Would you look at that. How many intellectual concepts were involved in the creation of that message?
1. I have just communicated with you through a code called the English Language.
2. I assume you can read the code.
3. I assume you understand what a nose is.That is what the A, C, G and T message was doing. Our body understands the ACGT code. And there is a rather rich individual somewhere in the world that is carrying out that message right now.
Now, let us imagine back at the dawn of time, perhaps billions of years ago, on a lonely, desolate planet there is a searing and hostile primitive soup all over the earth. No living thing exists, but for no comprehendible reason all these amino acids ‘happen’ to exist. But hang on, what is this? ... Look over there...wow! There is a single-celled organism that has got a code on it! The code is telling the organism to select amino acids in a special sequence so that the organism can reproduce itself. And, oh my goodness...look now: the code works! The cell's just divided and reproduced itself! That is very clever, and all without the chains being broken by the bubbling, hostile surface.
Now just how did the code come to exist? And how is the code understood? There is no reason why the ACGT sequence should make any more sense to the first cell that it did to you when you read it a minute ago. Where did the code and the means of translating it come from? They are both needed from the very start. The code is useless without the understanding of what it says, and the understanding of what it says is useless without a code being there to read.
So, to use the analogy of the text message, if I left my mobile on the table forever, it would never write and send you that message all on its own. The letters are there on the keypad, but what use is that unless we introduce some intelligence? Once I pick up the mobile and start texting, that is like the message telling the amino acids lying around at the beginning of time on the primitive earth what order to get into. You have got to introduce intelligence to get any sense out of the letters!
You actually need a significant amount of intelligence. A two-month old baby could never send you a text message about Simon Cowell that is powerful enough to reproduce his nose. If the baby could get the phone to work at all, they would send you random gobbledegook. DNA code must have an information source. The phone is not the information. Did the phone think up the message? Of course not! The phone has no knowledge of what a nose is.
The point is that information-rich messages which can reproduce life do not just happen. It must have had some thinking behind it. When DNA arrives on the scene, it is an instruction manual. That looks suspiciously like forward planning.
On the 28th February 1953, Francis Crick walked into the Eagle Pub in Cambridge and proclaimed, "We have found the secret of life!" He and James Watson had just discovered the structure of DNA. Nobody knew what its structure was before. Some were sceptical about its existence. For the rest of his life, Crick insisted that DNA could not have just happened. It could not be formed by chance.
Why can the building blocks of life not have just organised themselves and created DNA?
Use a book for example. Any book. I have just randomly picked up the 'Ultimate Visual Dictionary 2001' as it was close at hand. Flick through it, and you see it is full of loads of pictures and writing.
Like the DNA code, this book is full of ordered information in a readable code. What caused this book to exist? Was it ( a ) the work of an intelligent author/authors, or ( b ) the result of a terrorist who blew up a Dorling Kindersley printing press causing ink to fall on paper in random ways, which happened to create a whole book of sequenced meaningful English sentences, pictures that are relevant to the writing on the page next to them, and a glossary at the back that allows you to look up the word ‘Neptune’ and find the page that has organised, and at the time correct, information regarding the planet Neptune? Not only that, but it happens on a massive scale, falling in exactly the same places on thousands of other pieces of paper.
You cannot seriously expect me to believe that ( b ) is the best explanation? Crick and many other scientists would today say ( b ) is such a remote chance that it is no chance.
The building blocks of life could not have organised themselves and created DNA. That is like saying the ink on the page is the author of the book! You would be saying the ink is intelligent enough to think up the storyline and then write the words, commas, sentences, spell everything and design the pictures that have are remarkably identical to the subject at hand.
Ink cannot do that...only an intelligent designer can do that, and I believe that intelligent designer is God.
Wake up. You were dreaming. What's your name?
- Darth Rhyykol
- Jedi Master
- Offline
Re: Do you belive in God?
Counter quote
Introduction
Some people falsely believe that it is impossible to prove the unexistence of anything, but they are wrong. It can, for example, be proved that there is no even prime number greater than two. Other people use to say that there is no way to prove if there is a god or not, or even that we cannot get any knowledge of god (agnosticism). My opinion as a strong atheist, is that we can in fact prove that god does not exist in the physical world. This document is my attempt to do so.Definition of the word "god"
To prove the non-existence of god we first need to define the word "god". When christians talk about god they mean an almighty being. This, I think, is the only god that holds, since it is the only god that can be logically justified.I think it makes most sense if god is female, because only women can give life. Something that even people in the Stone Age understood. Later when wars affected the cultural evolution, and men took control of society, god became male, but the female god still lives on in the expression "Mother earth". It should also be pointed out that an omnipotent god must be either androgyne or sexless. However, in most religions god is male so I will refer to god as 'he', 'him' etc.
Some people (Einstein for instance) believe in a god who is not a personal god, but a Spinozan kind of god. I claim that this god is not a god! To say that god is universe - by getting knowledge of the universe we get knowledge of god - is to redefine the meaning of the word god. This has nothing to do with the word god as it was defined by the "primitive" cultures which preceded our present civilization. He can be excluded with Occam's razor, and most important: Such a god does not hear prayers.
If god is not omnipotent there is nothing that prevents him from being a product of the universe. If that is the case, what makes god divine? Then god would only be an alien, a being of matter; probably containing flesh, blood and DNA like all life we know of. Everything god is able to do would be things that human beings also will be able to do, all his knowledge would be knowledge we will also achieve. In fact humans would be gods, which should lead to some strange kind of humanism!
Many people justify their faith with god as an explanation. What is the meaning of life? Where does time and space come from? Who created the physical constants? et cetera. Because we lack knowledge of these things - and maybe never will, since they are questions like "what is the color of a second?" or "how does sound taste?" - god is there as an explanation.
Let's say that god is the meaning of life, what then is the meaning of god? If god has a nature, who created that nature? If god created time and space, how can god exist without it? Since creation is an event in time, how could god create time? and who created god? To answer these questions god must be almighty, or else you can't explain them. In fact you can if you say god stands above time and space and so on (which he indeed does if he is almighty), but to be able to prevent god from being tied to future phenomena, you must give him the quality of omnipotence so he can stand above everything.
The qualities of an omnipotent god
If god is almighty there are several qualities he must have. They are as follows:He must know everything. Everything that is, everything that has been and everything that will be. To be able to know everything that will be he must know every position and every momentum of every particle in cosmos (Laplace's "World Spirit").
He must be worth our worship. A being that is not worth worshipping is no god.
He must be able to do anything. If there are things that god can't do, he certainly is not omnipotent.
He must be above time. Something that even St. Augustine deduced. But not only that, god must stand above all possible dimensions.
He cannot be 'good' or 'evil' or, indeed, have any subjective characteristica. If god is all good, he cannot do evil things and cannot be almighty. Most people would object and say that good can do evil but chooses not to do it. Well, if god is all good he can't choose to do evil things, can he?
The theodicé problem
We also have the theodice problem, stated by David Hume:
If the evil in the world is intended by god he is not good. If it violates his intentions he is not almighty. God can't be both almighty and good. There are many objections to this, but none that holds since god is ultimately responsible for the existence of evil. Besides, if only god can create he must have created evil. If somebody else (the devil) created evil, how can one know that god, and not Satan created the universe?For a good look at the Theodicé problem try The problem of natural evil
Reasons not to believe in god
Heisenberg's uncertainty principle
I have refuted this argument myself. See Refuted proofs for an explanationThe ontological evidence against gods
Neccesary a god is a being that is worth worshipping, so if there is no being worth worshipping there cannot be a god.Not any of the existing religions can provide such a god. How do we know if there are no undiscovered beings worthy our submission? Well if there is a being that has either failed or not tried to communicate with us that being is not worth worshipping either, so the ontological evidence against god holds, even without complete knowledge of the world.
There is a test, based on the ontological evidence against god, that you can do to try the existence of god. Pray, and ask god to provide you with a clear proof for his existence within a week. After that week, if you have got a proof that god exists, send me the evidence. If not, there are only three reasons I can think of that are plausible: (1) God does not exist, (2) God does not want to or (3) God can't give you this evidence. Because of the ontological evidence, alternative (2) and (3) are not worth your worship and thus they equal alternative (1). So if you get no response there is no god.
The meaning of the word existence
What do we mean by existence? The very definition for existence is that a thing is said to exist if it relates in some way to some other thing. That is, things exist in relation to each other. For us, that means that something is part of our system ('The known world'). God is defined to be infinite, in which case it is not possible for there to be anything other than god because "infinite" is all-inclusive. But if there is nothing other than god then either god cannot be said to exist for the reason just explained, or god is the known world, in which case, by definition, god is not a god.Occam's razor
Occam's razor was formulated by William of Occam (1285-1349) and says: "Non est ponenda pluralites sive necessitate" or in english: "Do not multiply entities unless necessarily". It is a principle for scientific labour which means that one should use a simple explanation with a few explanatory premises before a more complex one.Let's say that everything must be created, and that was done by an omnipotent god. A god which stands above time, space, moral and existence, which is self containing and in it self has it's own cause. This entity can surely be replaced by the known world. The world stands above time, space, moral, existence, is self containing and in it has it's own meaning. Most theists agree that god has a nature. Then we must raise the question, who created god's nature? If we just accept that god has a nature and exists without a cause, why not say that the known world just is and that the laws of physics are what they are, without a cause?
God is not really an explanation, only a non-explanation. It is impossible to gain information from non-information so God as an explanation is a dead end. When we have said that the reason for something is that 'god did it that way' there is no way to understand it any further. We just shrug our shoulders and accept things as they are. To explain the unknown by god is only to explain how it happened, not why. If we are to investigate the world and build our views of life from the world, we cannot assume a god. Because adding god as an explanation leaves as many, if not more questions than it explains, god has to be removed with Occam's razor if we are serious in investigating the world.
Some things are impossible to do
There are things that are impossible to do. For example nobody can cover a two-dimensional surface with two-dimensional circles, without making them overlap. It is impossible to add the numbers two and two and get 666. You can not go back in time (without passing an infinite entropy barrier). The number of things that are impossible to do are almost infinite. If god were to be almighty he would be able to do them, but it's impossible to do so.Some people say that he can only do things that are logically possible to do, but what is? Is it logically possible to walk on water? Is it logically possible to rise from the dead? Is it logically possible to stand above time, space and all other dimensions - and still exist? I'd say that everything which violates the laws of physics are logically impossible and thus omnipotence is logically impossible. Besides if omnipotence is a relative quality there is no way to tell omnipotence from non-omnipotence. For omnipotence to be a valid expression it must be absolute, but we have no objective criteria to measure omnipotence so the word itself is useless.
Omnipotence is impossible due to paradoxes
Another way to disprove the almighty god is that omnipotence leads to paradoxes. Can god make a rock that is too heavy for him to carry? Can god build a wall that even he can't tear down?Also, if god knows everything, he knows what he will do in the "future" (in any dimension, not necessary the time dimension). He must have known that from the very start of his own existence. Thus god's actions are predestined. God is tied by faith, he has no free will. If god has no free will god is not omnipotent. Another way to put it is that to be able to make plans and decisions one must act over time. If god stands above time he can not do that and has no free will. Indeed, if god stands above all dimensions god is dimensionless - a singularity, nothing, void!
Besides there can exist no free wills at all if god is almighty. If you had a free will, god wouldn't know what you would do tomorrow and wouldn't be omnipotent.
The void creator
If everything must have been created, then god must have been created as well. If god is not created, then everything mustn't have a creator, so why should life or cosmos have one?Besides this argument has another leap. If everything has a source and god is that source, then god must have existed without it before he created it. So if god created time and space, he must live outside of time and space. Thus he is non-existent. If all life must come from something and that is god, god is not alive and hence non-existent. If moral must come from god, god lacks moral. If logic comes from god, god is illogic. If nature comes from god, god is unnatural. If existence comes from god, god is non-existent. If god is the cause of everything, god is void
We would never notice god
This is not an evidence against god, but rather describes the lack of sense in praying to a god who stands above time.If god stands above time and created time and space he can not be the first link in a time dependent chain of events. Rather he would affect every step in all chains, and we would only see god in the laws of physics (Davies, 1983, chapter 4). This god is an unnecessary entity to describe the world and should be removed with Occam's razor
If somebody would pray to god and god would listen, the laws would change to achieve the desired result. Thus the world would be different and the prayer would never have been said. Besides god would already (in an "above time" sense of view) know that you would pray, and already have changed the world. Prayers would be totally meaningless. We would already live in the best world possible, and any prayer would be to doubt the wisdom of god.
Even worse: For every prayer said, god has not acted, or else the prayer had been undone. This means that the more people have prayed, the more bad things in the world have persisted. Therefore, the more you pray, the more evil persist (provided god exists and stands above time).
A much better way to change the world is to do it yourself. Then you would know that it was you who made the world better. The effect of prayers are not scientific provable, whilst the effect of actions are. Instead of praying you should set to work at improving your situation. This is what humanism is about.
Nobody really believes in god
Schopenhauer once said something like:"Man can do anything he wants, but he can not want whatever he wants."
My thesis is that people who claim to believe in god do not really do so. They just wish to believe in god. They somehow feel that their lives are meaningless without god, so they choose to close their eyes to evidence against the existence of god. The christian view is well expressed by Cardinal Ratzinger:
"Religious liberty can not justify freedom for divergence. This freedom does not aim at any freedom relative truth, but concerns the free descicion for a person to, according to his moral inclinations accept the truth." (The times, June 27 1990, p9) [Translated to Swedish in the Swedish version of (Baigenth, Leigh, 1991) and then translated back to english by me]
It's as clear as it can be! For a christian you accept the "truth" according to your moral, and then have to be strong in your faith to keep your believes. You decide a priori what to believe and then try to convince yourself and others that it is true. But theists don't really believe, because to believe something is to take it for true, and just like in Nazareth's song Sold my soul there is no sign of god in the world. When you have the evidence for and against something your sub-conscious works on it and makes a conclusion. The process can't be affected by your will, only delayed or suppressed, which will lead to psychoses, and those are far more common among (catholic) priests than any other group..
I have personal experience of this believing what you want to believe. When I was a child I believed in a lot of crazy things. I thought my stuffed animals were intelligent. I believed in Santa Claus. I thought there were monsters under my bed at night. I even believed in god after I heard some of the tales from the old testament. Then I became older and realized that these things weren't true. When I look back I don't understand how I could believe in them, it must have been that I wanted to do so. (Except for the monsters, which had to do with fear of the dark)
When many religious people are confronted with criticism of their religion they convert to atheism or agnosticism. Examples of people who became critical to the dogmas of christianity are Charles Darwin (Darwin, 1958), Dan Barker (Barker, 19??), Ernest Renan plus many former "Catholic modernists" in the 19th century such as Alfred Loisy and Antonio Fogazzaro (Baigenth, Leigh, 1991). The Catholic modernism evolved in the late 19th century and was banned in 1907 by the Vatican (Baigenth, Leigh, 1991). These people are to me clear evidence that an enlightened person will after considering the facts, reject christianity and other religions that contain deities.
Note: This is not the "Plead to authority" fallacy. I'm talking people here, who were trying to prove the existence of god and turned atheists. They did not want to do this, but had to after reading a lot of books and doing a lot of thinking on the subject.
Epilogue
I have tried to define the only god that can be philosophically justified and show some examples why this god cannot exist. After reading this document you may object and say that god is beyond human understanding and can't be defined in scientific terms. This is the view of agnosticism.If god is so mysterious, how can we know anything about him? Through the Bible? How do we know that the Bible and not the Koran or the Vedha books, for example, are the words of god? (or the bible if you believe in any of the other two books). Considering the cruelties that have been made in the name of god, how do we know that not all religions are made by Satan?
If there is no way to know this but to trust people who claim they have had "divine experiences" there is no way to tell true from false prophets. One has to give up his free mind and follow the authority of a dictator. Remember also that it is the person making a positive claim who has to prove it.
"I wish to propose for the reader's favourable consideration a doctrine which may, I fear, appear wildly paradoxical and subversive. The doctrine in question is this: that it is undesirable to believe a proposition when there is no ground whatever for supposing it true." -- Bertrand Russell
"We shall not believe anything unless there is reasonable cause to believe that it is true" -- Ingemar Hedenius
Re: Do you belive in God?
wait he belives in satan but not god HOW IS THAT POSSABLE SATAN WAS AN ANGEL
Re: Do you belive in God?
What "everything i know is a lie"
I'm black....wait thats not right
